Haplogroup Q-L804 (Y-DNA)

Haplogroup Q-L804 (Y-DNA) is a Y-chromosome DNA haplogroup. Haplogroup Q-L804 is a subclade of Haplogroup Q-L54. Currently Q-L804 is Q1b1a1b below Q1b-M346.[1]

Haplogroup Q-L804
Possible time of origin	3,000-15,000 years ago
Possible place of origin	Beringia: Either East Asia or North Asia
Ancestor	Q-L54
Descendants	Q-Y9052, Q-A13540, Q-JN15, Q-Y16137, Q-Y7582
Defining mutations	L804 (rs1952836)

In 2000 the research group at Oxford University headed by Dr. Agnar Helgason first discovered the haplotype that was much later to become known as Q-L804. In 2000 the strange haplotype was called “branch-A” (i.e. R1b-branch A) and it was found uniquely on Iceland and Scandinavia.[2] Later studies completed the genetic bridge by determining that Q-L804 is related to Q-M242 populations of Native Americans, Turkmen (Q-M3) and Siberian populations of the Selkup and Ket people (Q-L54*xM3).[3] [4]

Origin and distribution

The origin of Haplogroup Q-L804 is uncertain. However it is likely to have originated in Beringia (North East Siberia) c. 15000 to 17000 yBP since it is closely linked to Q-M3 and to other haplogroups linked to the indigenous peoples of the Americas (over 90% of indigenous people in Meso & South America). Today, Q-L804 is found mainly in Norway and Sweden and in regions of North West Europe of Viking Age Expansion (British Isles, Atlantic Isles, Northern Germany, Normandy and Poland). The Q-L804 is also found among descendants of Scandinavian immigrants to North America. Haplogroup Q-L804 is defined by the presence of the (L804) single-nucleotide polymorphism (SNP). Q-L804 occurred on the Q-L54 lineage roughly 10-15 thousand years ago as the migration into the Americas was underway. It is likely that the split between Q-M3 and Q-L804 happened in the ancestors of the indigenous peoples of the Americas.

North Europe

Populations carrying Q-L804 are extremely thinly distributed throughout Northern Europe and among recent North European immigrants to North America. Since the discovery and definition of Q-L804 in 2014, three main subclades of Q-L804 bearing populations have been discovered in North Europe. The Q-Y9052 , the Q-JN14 and Q-Y7582. Of these three branches Q-JN14 has the widest distribution, ranging from Poland to Iceland, British Isles and France. Q-L804 is one of two subclades known as Q Nordic among genealogical communities. The Q-L527 is the other subclad of the Q Nordic.

Subclade distribution

Q-Y9052 (BY459). This lineage is found in Sweden, Norway and Germany.

Q-JN14 It has been found in Norway, Iceland, British Isles, Germany, France and Poland.

Q-Y7582 (BY386). This lineage has been found in Scotland, Iceland and England.

Technical specification of mutation

The L804 was discovered and defined by Thomas Krahn of Family Tree DNA's Genomics Research Center in 2012. [5] The technical details of L804 are:

Nucleotide change: T to A

Position (base pair):

Total size (base pairs):

Forward 5′→ 3′: GAATTCTGTGGGTGACTTTGTG

Reverse 5′→ 3′: GCACAGTGAAGAATGTGGGAC

Position: chrY:11,907,522

dbSNP151: rs765685783

Associated SNPs

Q-L804 is defined by the SNPs L804 and L805 and E324.

Phylogentic tree and Subgroups

Current status of the polygentic tree for Q-L804 is published by pinotti et. al in the article Y Chromosome Sequences Reveal a Short Beringian Standstill, Rapid Expansion, and early Population structure of Native American Founders. Calibrated phylogeny of Y haplogroup Q-L804 and its relation to the other branches of Q-L54.[6]

• Q-L54
  • Q-L330
  • Q-MPB001 (18.9 kya)
    • Q-CTS1780
    • Q-M930
      • Q-L804
      • Q-M3 (15.0 kya)
        • Q-Y4308
        • Q-M848 (14.9 kya)

Yfull.com's phylogenetic tree ver. 6.08.01 for for haplogroup Q-L804. Yfull's tree also include estimation of the age of the branches, and TMRCA (Time to Most Recent Common Ancestor)

• Q > Q-L472 > Q-L56 > Q-L53 > Q-L54 > Q-M1107 > Q-M930
  • Q-L804 formed 15200 ybp, TMRCA 3200 yBP
    • Q-Y9052 formed 3200 ybp, TMRCA 3200 yBP
      • Q-Y9294 formed 3200 ybp, TMRCA 2800 ybp
        • Q-YP5210
        • Q-Y9048
    • Q-A13540 formed 3200 ybp, TMRCA 2900 yBP
      • Q-JN15 formed 2900 ybp, TMRCA 1650 yBP
        • Q-Y16137
      • Q-Y7582 formed 2900 ybp, TMRCA 1650 yBP
        • Q-Y38488
        • Q-Y12445
        • Q-Y15622

Family Tree DNA Y-DNA haplotree for haplogroup Q-L804

• Q (M242) > Q-MEH2 > Q-M346 > Q-L53 > Q-L54 > Q-CTS3814 > Q-CTS11969
  • Q-L804
    • Q-BY387
      • Q-PH2487
      • Q-Y38488
    • Q-JN14
      • Q-Y16137
      • Q-BY66620
    • Q-BY459
      • Q-Y9291

The subtree Q-BY387 is found on Iceland, Scotland and England. The Q-JN14 is widely distributed in North-west Europe, but most kits are from Norway. The subtree Q-BY459 is by FT DNA mainly found in Sweden and Norway.

See also

• Human Y-chromosome DNA haplogroup

Y-DNA Q-M242 subclades

• Q-M242
• Q-L275
• Q-L330
• Q-L717
• Q-L940
• Q-L53
• Q-L54
• Q-L804
• Q-M120
• Q-M25
• Q-M3
• Q-M346
• Q-NWT01
• Q-P89.1
• Q-Z780

Y-DNA backbone tree

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
	"Y-chromosomal Adam"
		A00	A0-T [χ 3]
			A0	A1 [χ 4]
				A1a	A1b
					A1b1		BT
							B	CT
								DE						CF
							D	E		C		F
															F1	F2		F3	GHIJK
																				G	HIJK
																					IJK	H
														IJ	K
									I	J		LT [χ 5]		K2 [χ 6]
																L	T		K2a [χ 7]	K2b [χ 8]	K2c	K2d	K2e [χ 9]
																			K-M2313 [χ 10]		K2b1 [χ 11]	P [χ 12]
																			NO		S [χ 13]	M [χ 14]		P1	P2
																		N	O			Q	R
Y-DNA by population Y-DNA haplogroups of historic people Footnotes  Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809. International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.) Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). Haplogroup A1 is also known as A1'2'3'4. Haplogroup LT (L298/P326) is also known as Haplogroup K1. Between 2002 and 2008, Haplogroup T-M184 was known as "Haplogroup K2". That name has since been re-assigned to K-M526, the sibling of Haplogroup LT. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. (This followed the publication of: Poznik GD, Xue Y, Mendez FL, et al. (2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–9. doi:10.1038/ng.3559. PMC 4884158. PMID 27111036. In the past, other haplogroups, including NO (M214) and K2e had also been identified with the name "K2a". Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.; YFull YTree v5.08, 2017, "K-M2335", and; PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017) Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure. Haplogroup P (P295) is also klnown as K2b2. Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.) Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

References

1. Y-DNA Haplogroup Q and its Subclades - 2019, ISOGG
2. Helgason, Agnar; Stefánsson, Kári (September 2000). "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC 1287529. PMID 10931763.
3. Kivisild, Toomas (March 2017). "The study of human Y chromosome variation through ancient DNA". Human Genetics. 136 (5): 529–546. doi:10.1007/s00439-017-1773-z. PMC 5418327. PMID 28260210.
4. Karafet, Tatiana M.; Osipova, Ludmila P.; Savina, Olga V.; Hallmark, Brian; Hammer, Michael F. (2018). "Siberian genetic diversity reveals complex origins of the Samoyedic-speaking populations". American Journal of Human Biology. 30 (6): e23194. doi:10.1002/ajhb.23194. ISSN 1042-0533. PMID 30408262.
5. "Y-DNA Haplogroup Q and its Subclades - 2012". International Society of Genetic Genealogy. 7 August 2012. Retrieved 13 October 2019.
6. Pinotti, Thomaz; Bergström, Anders; Geppert, Maria; Bawn, Matt; Ohasi, Dominique; Shi, Wentao; Lacerda, Daniela R.; Solli, Arne; Norstedt, Jakob; Reed, Kate; Dawtry, Kim; González-Andrade, Fabricio; Paz-y-Miño, Cesar; Revollo, Susana; Cuellar, Cinthia; Jota, Marilza S.; Santos, José E.; Ayub, Qasim; Kivisild, Toomas; Sandoval, José R.; Fujita, Ricardo; Xue, Yali; Roewer, Lutz; Santos, Fabrício R.; Tyler-Smith, Chris (2018). "Y Chromosome Sequences Reveal a Short Beringian Standstill, Rapid Expansion, and early Population structure of Native American Founders". Current Biology. 29 (1): 149–157.e3. doi:10.1016/j.cub.2018.11.029. ISSN 0960-9822. PMID 30581024.

External links

• The Y-DNA Haplogroup Q-L804 Q Nordic Project
• Y-DNA Haplogroup Q and its Subclades - 2019